alomarilatifa alomarilatifa
  • 04-04-2018
  • Spanish
contestada

a carpenter used boards of length 9 7/9ft and 8 16/27ft in the construction of shelves. how many feet of board were used?

Respuesta :

xxmarkusyoungxp6n1kg xxmarkusyoungxp6n1kg
  • 04-04-2018
The answer is 18 and 10/27 because 7/9 x 3/3 =21/27 so 16/27+21/27 is 37/27 witch is 1 and 10/27 then you add 9+8 witch is 17 so 17 + 1 and 10/27 is 18 10/27.
Answer Link
kyrah4 kyrah4
  • 05-04-2018
The correct answer is 18
Answer Link

Otras preguntas

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how to i do 7/16÷(31/2÷1/2)
Please answer theses division problems!! 9 divided by 3/7
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds