BrishnaSiffray1
BrishnaSiffray1 BrishnaSiffray1
  • 05-04-2017
  • Mathematics
contestada

I need to know the answer

I need to know the answer class=

Respuesta :

Аноним Аноним
  • 05-04-2017
That equals 48 since you would just have to multiply 8 6 times like how the question stated. I hope that this helped
Answer Link

Otras preguntas

how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
what is the geometric mean between 6 and 20?
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
What property is shown by the equation? 1. 0 ÷ (–6) = 0
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
A generator stores electric current. Explain why you agree or disagree with this statement