mannybeava04
mannybeava04 mannybeava04
  • 01-07-2021
  • Mathematics
contestada

Do you agree? Explain why or why not.

Do you agree Explain why or why not class=

Respuesta :

scarletwitchz
scarletwitchz scarletwitchz
  • 01-07-2021

Answer:

if x = 4

[tex]\sqrt{8 + 1} + 3 = 0[/tex]

[tex]\sqrt{9} + 3 = 0[/tex]

3 + 3 = 0

6 = 0

wrong.

Answer Link
alexaaaisbvgb
alexaaaisbvgb alexaaaisbvgb
  • 01-07-2021
Yes as 8 + 1 is 9
Square root of 9 can be either 3 or -3 and -3 +3 is 0
Answer Link

Otras preguntas

A spring has a spring constant of 65.5 N/m and it is stretched with a force of 15.3 N. How far will it stretch?
How can Australia achieve economic growth
How did the physical geography of the South influence economic activity in the region?
Use this diagram and information given to find m_DFC. B C с А F KE D Given: m_AFB = m_EFD = 35° Points B,F,D and points E, F, C are collinear. The measure of ZD
What’s the area of this figure?
In what way does the Texas Constitution include the principle of federalism? A.) Texas is able to have its own treasury and print its own currency B.) Texas is
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
ready readyup here we go
What losses and opportunities did Mexican Americans have in the Westward Expansion?
Please answer Will give brainlst