kekebadd9903 kekebadd9903

02-03-2021
Mathematics

contestada

Xinyi bought a box of 20 cupcakes.12 of the cupcakes are chocolate cupcakes.What is the percentage of chocolate cupcakes

Respuesta :

bluxerainbow20 bluxerainbow20

02-03-2021

The answer is 60%, 60 percent are chocolate flavored cupcake

Answer Link

Otras preguntas

Which individual is correctly paired with the historical event he helped influence?

Personal care quiz---when providing nail care it is important to consult a professional true or false

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

Find the area of a kite with diagonals 10 & 5

_____design in construction engineering may show that you need to excavate at the construction site before you can buildA. TopographicalB. GeographicalC. Geol

great Britain is an example of a core nation True or False

If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?

Which of the following has faces that are pentagons?A. HexahedronB. OctahedronC. IcosahedronD. Dodecahedron

Which statement best describes Washington’s economy in the decades following World War II? A. Economic activity flattened and stagnated. B. Economic activity i

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat