castroashley4499 castroashley4499
  • 04-01-2021
  • Mathematics
contestada

asaps
In which number is the value represented by the digit 9 equal to 1 of the value
represented by the digit 9 in the number 73,951?

asaps In which number is the value represented by the digit 9 equal to 1 of the value represented by the digit 9 in the number 73951 class=

Respuesta :

Adetunmbiadekunle Adetunmbiadekunle
  • 09-01-2021

Answer:

The number is 83,194

Step-by-step explanation:

The value of 9 in the given number is 900

So

out of all the options, we want a number in which the value of 9 there is 1/10 of 900 which is 90

The correct answer here is 83,194

Answer Link

Otras preguntas

according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
how can you write 0.45 as fraction and a percentage ,please show work
How much money, in dollars, does one mole of nickels represent?
What are the factors of 6x + 24?
Do all your pet's offspring look the same? If no, then explain why they look different.
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.