uppuganti2824 uppuganti2824
  • 01-10-2020
  • Mathematics
contestada

State whether the lines are parallel, perpendicular, or neither. Show your work.
10x–5y=100 and 6y+3x=−7
PLZ SHOW WORK

Respuesta :

dd22222 dd22222
  • 01-10-2020

Answer:

-5y=-10x+100

y=2x-20

6y=-3x-7

y=-1/2x-7/6

Perpendicular because the slopes are opposite

Answer Link

Otras preguntas

True or false? physical factors affecting community health include geography, community size, and industrial development.
Name all of the traits that the mackerel has, based on this cladogram.
Which of the following props should you suggest to clients with tight muscles and physical restrictions? A. Pillow and an exercise block B. Exer
Brainliest to most helpful! Answer asap! The point (−3, 1) is on the terminal side of angle θ, in standard position. What are the values of sine, cosine, and ta
__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging
Racing other drivers, tailgating, and attempting to beat a train to a railroad crossing are possible consequences of __________ when driving while impaired. A.
Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.
Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
^5sqrt4x^2 ^5sqrt4^2