maddiecat
maddiecat maddiecat
  • 03-09-2018
  • Physics
contestada

Which of the following is a vector quantity? Question 4 options: distance velocity speed time

Respuesta :

Celeene
Celeene Celeene
  • 03-09-2018
The answer should be velocity distance is a scalar as it has magnitude but no direction and so is time so distance over time gives speed which leaves velocity because displacement has both magnitude and direction
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what is the lcd of 10/11,29/44
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
Fossils are most commonly found in which type of rock?
How do you put allele in a sentence