ashashashkes ashashashkes

04-06-2018
History

contestada

South Vietnam had invaders come from which of the following countries? Laos North Vietnam Cambodia China

Respuesta :

sandy8866 sandy8866

08-08-2018

the answer is B. North Vietnam

Answer Link

saraherickson36 saraherickson36

15-04-2020

Answer: B.) North Vietnam

Explanation:

Answer Link

Otras preguntas

Determine whether the lines below are parallel, perpendicular, or neither. * y=2x+9 x-2y=-6

Q15. The distance between two villages on a map measures 6.2 centimetres. The map has a scale 1:25000 What is the actual distance between the two villages in ki

help pls im confused

greater freedom of_at that time than England.

Carl pays $79.99 for a Disney+ subscription every year. Because Carl It's such a Disney fanatic he also purchases the extra $30 per movie to gain early streamin

Please please please help me asap!

What was the difference in population and area between the city-state of Athens and the Roman Republic?

More than _____ percent of Earth is covered by water. eighty ninety-five sixty seventy

what happened to twilight sparkle in the new movie?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'